Вопросы с тегом 'bulbs'

В этом тоже есть смысл. Я думаю, что в моей сфере люди имеют трудное время мысленно вниз-весовые количества публикации на пост-дока приложений. На работу я хотела, мне сказали, что человек, который получил это сделал ...
23

Я не могу подключиться к новому маршрутизатору с SSID, который старше маршрутизатор

После некоторого копания я в состоянии разобраться относительно простое решение для первое и самое важное требование, который, держа шапку в нижней части. Необходим root (конечно - тянуть и толкать файлы) и базовый навык использования apktool. Для предварительно скомпилированных дисков: Установить apktool. Установите свой фреймворк-Рес.АПК путем выполнения apktool если /путь/к/рамочные-Res.АПК. Декомпилировать ваш services.jar путем выполнения apktool д /path/to/services.jar. Перейти на декомпилированный услуг.фляги.из папк ...
2 мар. 2021 г., 11:58:28
21

файл отображение мета-данных в форматированные столбцы

В некоторых дистрибутивах нужен установщик, чтобы сделать ISO-образ загрузочного на USB (например, USB для установки) , другие требуют, что вы делаете образ (например с диска тепловизор) чтобы сделать ISO на загрузочный USB. Я не могу сказать, какой метод является более вероятно, на работу на неопределенный версию Ubuntu. ...
24 июл. 2021 г., 02:04:52
22

Откуда он взял ножницы 2 и 4 документы?

У меня есть личный аккаунт разработчика и мой друг, соединяющей его банковского счета на мой счет разработки Apple. Потому что я разработал приложение, так что я хочу, чтобы мое имя под названием мое приложение на магазин приложений, а не имя моего друга. Я все еще могу быть продавцом приложение, даже если оплата на банковский счет моего друга? ...
7 апр. 2014 г., 08:54:33
18

Архивный файл с датой-штампом

Это очень странно, похоже, что у вас есть три варианта gstreamer0.10-плагинов-плохо : Установленная версия не актуальная : 0.10.22-2 Доступная версия-дата : 0.10.22-3 Версии ВТФ : 0.10.22-0.1 Я думаю, что вам надо удалить этот "0.10.22-0.1" версии, в так или иначе. Вы можете попробовать : apt-получить установку gstreamer0.10-плагинов-действительно-плохо=0.10.22-0.1 или с dpkg -Р gstreamer0.10-плагинов-действительно-плохо Для того, чтобы удалить версия 0.10.22-2 или 0.10.22-0.1. После этого у вас есть только 1 версия данного пак ...
26 дек. 2014 г., 20:59:02
23

Как я могу запретить перезапись харчи при использовании двойной загрузки машины

Когда вы приземлитесь на кого-то, и они владеют, что пространства, вместо того, чтобы платить аренду вы можете просто использовать карту, которая говорит, перемещаться в любом пространстве. Как можно двигаться куда-то еще, пока она еще твоя очередь. ...
16 авг. 2017 г., 13:11:25
25

Пользовательское восстановление, пользовательские ROM для Micromax холст сок 3 плюс q394

Вы можете сделать: ф=0 для ARG В -Е-в сделать ф=$((ф+1)) тр '>\N' в '\п>' <входной_файл | команда grep "$арг" '>.\{200\}'| тр '>\N' в '\п>' >"./выходной_файл$Ф" сделано Который будет писать все последовательности 200 символов или больше outfile1 и всех тех, короче outfile2. Он переводит все > к \пewlines и наоборот - так что ваш первый пример выше становится: TCONS_00000066 gene=XLOC_000030>CCGCCGGCTGCTGCGCGCACCGACTTGTCACCACCCCAGCACGTCCTCCACGTATACAAG>CGCTACGGTCCACCGCGGCAGCGTCGACGTCCTTGTCCGCAAACATGGTGGTGGCAGCTT>CCTCATCGAGCAGCAGCAACTCATCCTCGAGGGGAAGG ...
10 янв. 2016 г., 11:43:38