Пользовательское восстановление, пользовательские ROM для Micromax холст сок 3 плюс q394

Вы можете сделать:

ф=0
для ARG В -Е-в
сделать ф=$((ф+1))
 тр '>\N' в '\п>' <входной_файл |
 команда grep "$арг" '>.\{200\}'|
 тр '>\N' в '\п>' >"./выходной_файл$Ф"
сделано

Который будет писать все последовательности 200 символов или больше outfile1 и всех тех, короче outfile2.

Он переводит все > к \пewlines и наоборот - так что ваш первый пример выше становится:

TCONS_00000066 gene=XLOC_000030>CCGCCGGCTGCTGCGCGCACCGACTTGTCACCACCCCAGCACGTCCTCCACGTATACAAG>CGCTACGGTCCACCGCGGCAGCGTCGACGTCCTTGTCCGCAAACATGGTGGTGGCAGCTT>CCTCATCGAGCAGCAGCAACTCATCCTCGAGGGGAAGGGCCCAGAGCTTCTAATCCTACA>CGGCAACAACACTTTATACTTGTGTATAATTTCTCTTCGTTTCTGAGTTCATGGCTATCT>TTGTCTCTCTTATCTTCTCCCTTTTGCTATCTCTATATTTGTGATTGCCATGGAAATACA>

Он соответствует (или не) 200 символов, начиная с первого, происходящие > для каждой входной линии. Для первой итерации для петли - та, которая соответствует линии с 200 символов или больше - это меняет перевод на линиях, которые грэп играм и записывает результаты в outfile1. Вторая итерация получает более короткие последовательности и записывает их в outfile2.

Следует отметить, что этот счет будет включать в себя любые символы новой строки, что были в данных.

Вот еще один способ, который не имеет этой проблемы:

СЕПГ -Н -/^>/!{Ч;$!д
}; х;с/\н[ACGT]\{20\}/&/4Р
'<входной_файл >выходной_файл
+856
cpf 10 янв. 2016 г., 11:43:38
25 ответов

Skype не входит в PPA, это часть официального РЕПО. Обычно для просмотра информации о пакете располагается в подрубрике странице ППА, однако для этого вам не как Skype является всего лишь частью партнера РЕПО, а не в НПА.

+992
Romain Beuque 03 февр. '09 в 4:24

поэтому я недавно купила телефон от рынка facebook и обманули с демо-телефону. Его новый телефон даже не царапина, но я демо высвечивается каждые 30 секунд. Я хочу искоренить ее, и я остановлю свежий стек ROM, но не могу разблокировать загрузчик. Я следовал несколько туц на YouTube и XDA, но не мог заставить его работать. Кто-нибудь сталкивался с подобными проблемами ?

screenshot screenshot
Нажмите на изображения для увеличения вариантов

+942
tianhaopx 4 июн. 2013 г., 22:09:33

Вам нужен второй шаг, чтобы скрыть его от прямых сетки, а также чтобы убедиться, что он не появится, на ваш взгляд, цены на Windows 7 и т. д.

  1. Синхронизация ваших фотографий, позволяя iTunes, чтобы создать папку в папке Pictures, как обычно
  2. Скопируйте эту папку на место, кстати, мне нравится использовать, когда iTunes сохраняет остальные данные (и нужно выложить фото кэша ИМХО):

C:\Users\User имя\музыка\\iTunes программа iTunes СМИ

Примечание: Вы можете поставить ее на акцию или другой диск, если вы хотите, как долго, как вы используете мягкую ссылку (что мы сделаем ниже)

3.Создать символическую ссылку. Я использовать MKLINK из SDK для Windows.

Откройте окно командной строки от имени администратора и введите:

компакт-диск C:\Users\User имя\картинки

MKLINK /D "для iPod фото кэш" "C:\Users\User имя\музыка\iTunes\iTunes медиа\iPod фото кэш"

Затем вы увидите папку появляются в папке "Изображения" со знакомыми "ярлык" стрелка.

4.Правой Кнопкой Мыши папку и выберите "скрыть папку"

Когда он спрашивает, Если вы хотите скрыть только для этой папки или все папки и файлы, выбираете только для этой папки

Тада! Ваш iTunes (который знает имя и ищет его в код), найти файл и обновить базу данных правильно в его новом месте, но любую картинку / файл услуг (Zune, то проводник Windows Live сетка) будет не забрать каталог.

+927
Max Bobcat 2 мая 2017 г., 00:03:40

У меня есть несколько именованных файлов журналов :

  • 2016-02-10_03-52.журнал
  • 2016-02-10_04-43.журнал
  • 2016-02-10_02-13.журнал
  • ...
  • 2016-03-15_07-03.журнал
  • 2016-03-15_09-08.журнал

В основном картина : ГГГГ-ММ-DD_.журнал

Я хотел бы создать тар из всех файлов, начиная с той же схеме, как :

  • 2016-02-10.тар
  • ...
  • 2016-03-15.тар

Дело в том, что я не знаю шаблон заранее только его структура.

Я не знаю, как искать файлы, начиная с той же (неизвестной) образец .

Любая помощь высоко ценится. Спасибо

Согласно "номинальной животное" Решение ниже :

экспорт Ланг=с значение lc_all=с найти . -название '[0-9][0-9][0-9][0-9]-[0-9][0-9]-[0-9][0-9]*' -е '%ф\п' | СЭД -е 'с|.$||г' | СНП | тр | а прочитать имя ; делать найти . -имя "${имя}_" -е '%р\н - | тар-кжф "${имя}.ХZ" -Т - --нет-Конец цитаты сделано

+893
sai umesh 12 нояб. 2023 г., 12:48:17

Автоматическая установка может также сделать с помощью udisks средство командной строки. Это современная замена для GNOME-гора. Это не гном.

При подключении обычно диск с помощью файлового менеджера (Наутилус и т. д.) он монтирует диски, взаимодействуя с udisks за кадром.

Вы можете сделать то же самое в командной строке с помощью udisks.

/usr/Бен/udisks --смонтировать /dev/sdb1

Немного после --крепление - это устройство, название раздела, который вы хотите смонтировать. (в/dev/что-то)

Найти имя устройства раздела

Открыть свой раздел в Наутилусе (это означает, что он установлен) тип крепления в терминале. Вы должны увидеть строчку с вашим именем диск, как:

на /dev/sdb1 в /Media/мой-счастливый-диск тип vfat ....
+793
nofaiture 21 февр. 2013 г., 21:22:05

Возможно ли сознание без самостоятельного смысла? Разве осознание предполагает собой осознание не важно, насколько изысканным и тонким, что самоощущение может быть? Или слегка переформулируйте вопрос - может быть осознание недвойственного т. е. осознавая субъекта без объекта.

Большое спасибо, как всегда

+733
Shan Eapen Koshy 8 сент. 2023 г., 04:16:50

Этот сервис метод не работает для меня на моем Samsung устройства. Я придумал, как это сделать, настроив сетевой интерфейс напрямую, хотя. Вот скрипт, который настраивает компьютер с Linux и USB-подключении корневого устройства Android для USB модема. Это не настроить DNS-сервер или NAT-маскарадинг, но достаточно, чтобы сделать устройство доступным на 192.168.42.129:

#!/бин/Баш
набор -euo pipefail

# Настройка USB модема для Андроид устройства.
# Использование: АБР USB-трос [кабель USB поставщиков и USB-продукта]
# Если продукт USB производитель/неопределен, использовать первый USB сетевой интерфейс.
# На стороне Андроид, модем включен через АБР оболочки.

если [[ $# -экв 2 ]]
тогда
любой=ложь
поставщик=$1
продукт=$2
еще
любой=истина
интернет

функция find_if() {
 локальный путь, если
 на пути в /sys/класс/чистой/*
делать
 если и=$(и basename "$путь")
 если [[ "$(и более ранних версий "$путь")" == */USB интерфейс* ]]
тогда
 местные ifvendor ifproduct 
 ifproduct=$(кошка "$(реального пути "$путь")/../../../idProduct")
 ifvendor=$(кошка "$(реального пути "$путь")/../../../idVendor")
 если $любой || [[ "$ifproduct" == "$продукта" && "$ifvendor" == "$поставщиком" ]]
тогда
 Эхо "найдено интерфейса: $если" 1>&2
 Эхо "$, если"
вернуться
интернет
интернет
сделано
}

adb_shell функция() {
 АБР оболочки "$(е "%м" "$@")"
}

adb_su функция() {
 местные цитирует
 процитировал="$(е "%м" "$@")"
 АБР оболочки Су-C "$(Е %Д "$кавычках")"
}

если=$(find_if)
если [[ -Z "на$Ли" ]]
тогда
 эхо "с просьбой интерфейс:" 1>&2
 adb_su как правило Сыс.USB-кабеля.конфигурации RNDIS для АБР
 Эхо "> > " ок "" 1>&2
интернет

в то время как [[ -Z В "если" ]]
делать
 Эхо "ждут сетевое устройство..." 1>&2
 сон 1
если=$(find_if)
сделано

пока ! ( IP-связи | грэп -ФК "долларов" )
делать
 Эхо "ждут интерфейса..." 1>&2
 сон 1
сделано

configure_net функция() {
 местное название="$1"
 местные если="$2"
 локальный IP="$3"
 локальная Таблица="$4"
 местные cmdq="$5" команда запроса # 
 местные cmdx="$6" команды конфигурации # 

 если ! ( "$cmdq" IP АДР шоу Дэв "если" | команда grep -ФК 192.168.42."$ИС" )
тогда
 Эхо "настройка $имя интерфейса адресу:" 1>&2
 "$cmdx" ірадреса добавить 192.168.42".$ИС"/24 Дев "$, если"
 Эхо "> > " ок "" 1>&2
интернет

 если ( "$cmdq" IP АДР показывают Дэв "если" | команда grep -ФК 'государства' )
тогда
 Эхо "приведение интерфейса $имя:" 1>&2
 "$cmdx" IP-связей комплект Дев ", если" вверх
 сон 1
 Эхо "> > " ок "" 1>&2
интернет

 если ! ( "$cmdq" IP-маршрут показать таблицу "$стол" | команда grep -ФК "192.168.42.0/24 Дев $если" )
тогда
 Эхо "настройка $название маршрута:" 1>&2
 "$cmdx" IP-маршрута добавить таблицу "$Таблица" 192.168.42.0/24 Дэв "если"
 Эхо "> > " ок "" 1>&2
интернет
}

configure_net местных "долларов, если" 128 основной команды sudo
configure_net устройства rndis0 129 местного adb_shell adb_su

Чтобы включить переадресацию (т. е. подключения к интернету с ПК через Android-устройство), см. мой вопрос и ответ здесь.

+658
user33032 13 дек. 2023 г., 22:38:11

Ну есть и хорошие новости и плохие новости. Хорошей новостью является то, если вы держите его приготовления, протеины в конечном итоге сломать и мясо будет мягче. Плохая новость в том, кипящую так долго, возможно, потратил благость мяса.

Однако более хорошие новости. Мясистый добра, скорее всего, были переданы в бульон. Вы можете превратить ваше блюдо в маленький кусочек тушенки, и никто не будет мудрее, и бульон будет давать отличный вкус корень овощи можно добавить в рагу. (Картофель, пастернак, репа, морковь и т. д.)

+631
Cithel 3 дек. 2023 г., 13:44:33

Многие настольные игры используйте квадратные карточки, которые 70 мм × 70 мм, о 2¾".

Есть ли что использовать большие площади карты? Если это так, что самая большая площадь карты, которая находится в использовании?

Я в основном интересно, если есть любой квадрат карты больше, чем 70мм. Я работаю над игрой, которая нуждается в квадратных карт, а 70мм не достаточно большая. Компания я хочет использовать размеры карт, которые уже используются, где это возможно.

Почему карты должны быть большими, потому что люди ставят маркеры на них сверху, когда они в игре, а не потому что у них есть, чтобы отобразить много информации.

+562
Banjobum 21 июл. 2018 г., 18:14:50

Ответ в том, что я тупица. Жаль всех. Видимо, это и есть сочетание клавиш, что делает его прошивки. Вот почему я не могу иметь хорошие вещи.

+554
david rocha 2 авг. 2014 г., 10:18:46

Некоторое время назад, я символические ссылки на них мой ~/библиотеки/загрузок почтой каталог ~/загрузки , так что мои вложения электронной почты будут загружены в ту же папку, что все мои другие приложения скачать файлы.

Когда я обновился до горного льва, я заметил, что Почта загрузок папка была восстановлена. Так что я ее удалил и воссоздал симлинк таким же образом я сделал для предыдущих версий ОС Х.

Теперь, каждый раз, когда я пытаюсь скачать или быстрая-смотри вложение в сообщении электронной почты.приложение, я вижу следующее сообщение об ошибке (не может быть точным; перевод с испанского):

Почты не удалось сохранить вложение "..." на диск. Убедитесь, что папка Загрузки имеет разрешения на запись.

Некоторые исправления, которые я пробовала:

  • Делая ~/загрузки доступен на запись.
  • Удаление символической ссылки и повторного создания каталога.
    • Делая этот мир-каталога для записи.
  • Восстановление права через Дисковую утилиту.
  • Изменение расположения папки Загрузки предпочтений по почте.приложение к ~/загрузки.

Как мне восстановить функциональность своей почты, загрузки папку (желательно так, чтобы это символические ссылки на них в моем родном загрузки папку)?

+530
delephin 15 дек. 2019 г., 06:36:14

Я не хочу, чтобы сохранить что-нибудь—просто протрите крен, как можно было бы переформатировать карту памяти цифровой камеры. Есть ли простой некомпьютерного маршрут? Если нет каких-либо настройки системы, делать любые приложения этого?

Предположим, у меня есть слишком много, чтобы удалять по отдельности (1,000+).

+364
albodelu 24 февр. 2015 г., 14:41:56

Я имел эту проблему тоже, но там не было никаких резервных копий, указанных в настройках. Мое решение вращались вокруг не имея мой внешний подключенный жесткий диск, который является, когда iTunes был хранить мои файлы резервной копии iPhone. Подключение жесткого диска решить эту проблему.

+336
Andrei Spatariu 30 нояб. 2016 г., 20:49:08

В зависимости от того, где вы живете, есть разные варианты. Я бы предложил, если в США, чтобы пойти с одной из больших платформ, таких как Kraken.comили CoinBase.com. В этих системах вы можете перевести средства (Кракен) или прикрепить к банковский счет для покупки валюты.

По моему опыту, компания будет быть твоим тренажером. Трудно увидеть то, что вы покупка/продажа как фактическая сделка происходит автоматически при нажатии кнопки. То, что вы видите не то, что вы получите (если все изменилось в последнюю неделю). Однако она очень проста в использовании.

Кракен потребует дополнительной проверки дополнительные уровни (работа с большим значением). Но вы можете контролировать торговле. Вы можете установить лимиты покупки/продажи, которая означает, что вы не получите 1 копейку меньше, чем то, что вы сказали это. У них есть тонны дополнительных вариантов торговли, если вы хотите узнать больше, а также дополнительно.

Заключительное Примечание, Кракен поддерживает многие другие крипто валюты варианты и купил cryptowat.ч более года назад на хороший живой корм, цены на нескольких платформах.

Надеюсь, это поможет вам начать!

Редактировать: я здесь не для того, чтобы судить о намерениях или жизнеспособности. Вопрос был "что я могу использовать". Любые предположения (в том числе комментарий по текущей рыночной, политической, правовой и т. д.), Кроме как "я просто отвечаю на вопрос" было бы некорректно.

+330
user260765 20 мар. 2011 г., 23:30:04

Ли ваш беспроводной сети в режиме точки доступа.

Первое, что нужно сделать-это выполнить проверку, является ли ваш беспроводной поддержка карты переходит в режим беспроводной точки доступа. Как рассказал ранее следующая проверка в рамках mac80211 для драйвера.

Установите МВ и выполнение следующих

судо способность установить ВВ
список ИУ 

Искать поддерживаемый интерфейс раздела, где должна быть запись под названием АП , как показано ниже

Поддерживаемые режимы интерфейс:
 * ОПБН
 * управляемые
 * АП
 * АП/ВЛАН
 * монитор
 * сетка точка

Если драйвер не показывает этот АП, это не значит, что он не может создать беспроводные точки доступа. Но эти карты не в рамках данного учебника. Дополнительные тесты следовать документации Ubuntu в режиме Master.

Установка разделена на три части,

  1. Настройка узла беспроводной сети
  2. Настройка IP-адресу
  3. Общий доступ к интернету

1.Установки и размещения в сети

  • Необходимое программное обеспечение: hostapd Install hostapd (установки)
  • Нажмите АЛТ + Ф2 и типа gksu редактора gedit & нажмите клавишу Ввод. Мы собираемся редактировать много файлов.
  • В gedit, нажмите сочетание клавиш Ctrl+о, сочетание клавиш Ctrl+л и вставьте его в поле расположение файла/etc/hostapd/hostapd.конф. Нажмите Клавишу Ввод.
  • Вставьте следующий код,

    интерфейс=как wlan0
    водитель=nl80211
    идентификатор SSID=тест
    hw_mode=г
    канал=1
    macaddr_acl=0
    auth_algs=1
    ignore_broadcast_ssid=0
    ВПА=3
    помощью wpa_passphrase=1234567890
    wpa_key_mgmt=ВПА-ПСК
    wpa_pairwise=ТКИП
    rsn_pairwise=САМПР
    

Пожалуйста, убедитесь, что нет пробелов в конце строк и в конце линии! Hostapd является очень чувствительной к прекращению пробелов, которые трудно устранить!

Изменения вам нужно сделать:

  1. Изменить интерфейс=как wlan0 для вашей беспроводной карты имя. (Если у вас одна беспроводная карта должна быть как wlan0)
  2. идентификатор SSID=тест. тест - имя вашего размещенной сети.
  3. помощью wpa_passphrase=1234567890, 1234567890 - пароль вашей сети.

Конфигурация выше создает WPA и WPA2 с поддержкой точки доступа в г режиме. Более подробную инструкцию для создания файла конфигурации можно найти здесь

Теперь запустить hostapd. Отредактировать файл /и т. д./По умолчанию/hostapd и изменить линию DAEMON_CONF такой:

DAEMON_CONF="в/etc/hostapd/hostapd.конф"

Затем запустить hostapd услуги, используя следующую команду

судо служба hostapd начать

Он должен начать беспроводную сеть. В вашем мобильном устройстве, теперь вы можете видеть беспроводную сеть и может пройти проверку подлинности. Но устройство не получит IP-адрес. Остановить его с помощью команды судо служба hostapd стоп

Если вы получаете любые ошибки, возможно ваша карта не поддерживает гр режим. Попробовать с другими >режима. Руководство

Часть 2: настройка сервера DHCP для управления IP-адресу

Установить , что ISC-DHCP-сервер Install isc-dhcp-server

Отредактировать файл /и т. д./По умолчанию/от ISC-DHCP-сервер и набор интерфейсов такой:

Интерфейсы="как wlan0"

В gedit, нажмите сочетание клавиш Ctrl+О, в расположении вставка в/etc/dhcp-сервер/в dhcpd.конф Найти (сочетание клавиш Ctrl+Ф) ниже линии и поставить # перед ним. Он должен выглядеть после редактирования

определения параметров # общие для всех поддерживаемых сетей...
#вариант доменного имени “example.org”;
#вариант доменного имени-сервера ns1.example.org, ns2.example.org;

Снова закомментируйте следующие строки тоже

#по умолчанию-аренды-600 раз;
#Макс-Лиза-времени 7200;

Добавьте следующие строки в конец

подсети 10.10.0.0 маска 255.255.255.0 {
 диапазон 10.10.0.2 10.10.0.16;
 вариант доменного имени-сервера 8.8.4.4, 208.67.222.222;
 вариант маршрутизаторы 10.10.0.1;
}

Диапазон описывать как долго пул адресов будет. вам нужно отрегулировать значение подсети. Эта конфигурация может дать IP до 15 устройств

Снова нажмите Cctrl+часов в Gedit и вставьте следующее в адресную строку в/etc/сети/интерфейсов, добавьте ниже

авто как wlan0
как wlan0 iface защитный инет статический
адрес 10.10.0.1
сетевая маска 255.255.255.0

как wlan0 ваш беспроводной интерфейс. Изменить его соответствующим образом.

Примечание: после перезагрузки беспроводная будет показано, как не удалось. Так вы не могу использовать любой другой Wi-Fi сети. Чтобы получить беспроводной с нормальной поведения, поставить # перед теми добавленную строку и выполнить команду sudo запустить сетей

теперь бегите

судо услуги от ISC-DHCP-сервер запустить

судо служба hostapd начать

На данный момент , ваше мобильное устройство будет видеть сети, проверки подлинности и после проверки он будет получать IP-адрес что-то вроде 10.10.0.2.

Настройка параметров подключения к интернету

Для подключению к интернету нам нужны IP-пересылки и IP-маскарадинг. Включить пересылку IP : выполнить

Эхо 1| судо тройник /труды/системы/нетто/протоколов IPv4/ip_forward

Теперь говорят, что вы используете для доступа/подключения USB-модема для подключения к интернет. Вы должны получить логическое имя интерфейса. Для этого выполнить команду ifconfig или IP-адрес

Для удаленного доступа/USB-модем: он должен быть ppp0. Если вы хотите поделиться подключение Ethernet, вы должны использовать ethxбылгде X-ваш Ethernet устройства. Если вы подключаетесь к интернету через Android устройство с USB-модем, то имя интерфейса должно быть интерфейс USB0.

Теперь после того как вы получите имя интерфейса выполнить судо в iptables -Т физ-а POSTROUTING -с 10.10.0.0/16 -О ppp0 -J в маскарад

В ppp0 в выше команды-это интерфейс, подключение к интернету вы используете беспроводную.

Если вы редактировали до /и т. д./сети/интерфейсов, вы можете использовать этот скрипт для запуска службы. Редактировать его, если вы не разделяя ppp0. если вы используете скрипт и вы хотите остановить сервер, использовать судо killall hostapd


Блог, который, в основном, краткое изложение того, что было описано здесь: http://dashohoxha.blogspot.com/2013/06/how-to-setup-wifi-access-point-on-ubuntu.html

Скрипт, который пытается автоматизировать действия, описанные здесь: https://gist.github.com/dashohoxha/5767262

Пожалуйста, не стесняйтесь сообщить или исправить любые ошибки, которые вы заметили.


Отлично помогает от :

+311
Al Sunseri 17 дек. 2012 г., 07:59:12

Привязать ключ (г к "вам" рекомендуется) для протокола IMAP-принеси почте в ваш ~/.muttrc.

 персонализация индекс г имап-принести почту

Нажимая г в то время как в индексе теперь принести Новой почты с сервера IMAP.

(для поп-пользователей, принести почты функция получает почту с Pop-сервера)

+303
Laura Baity 8 мая 2021 г., 19:52:59

Насколько я знаю, некоторые авиакомпании допускают одну букву проверку орфографии (например, см. http://www.flyertalk.com/forum/india-based-airlines/1510058-name-spelt-wrong.html - "в рамках ИАТА правила, применимые для ВВС Индии, однобуквенный транспозиции не должно быть проблемой", - хотя я не мог найти фактический ИАТА ссылка). Однако, вы должны как можно скорее связаться с авиакомпанией - не ждите, пока вы добраться до аэропорта!

+301
Sargo Krisstoffer 11 янв. 2011 г., 12:48:03

Вдруг в Ubuntu я не смог просмотреть содержимое одного из моих разделов. Они действительно существуют. Я могу видеть их в Windows, но не в Ubuntu. В раздел NTFS.

Когда я пытаюсь смонтировать раздел, я получаю ошибка ввода/вывода.

Как я могу решить эту проблему?

+275
stawtsew 9 апр. 2021 г., 23:56:03

Лучше иметь 6 месяцев на ваш паспорт летают в Европу и окрестности.

Же самое относится и собирается в Турции, они тоже довольно жесткие (я слышал от друзей). Кроме того, вам понадобится эвиза напечатано и в вашем владении до посадки некоторые рейсы из Великобритании в Турцию.

Жаль, что вы попались на это. Им не уверен, если ее официальный государственный / правила ЕС или какой-то дополнительный стандарт, введенной пограничный контроль, но, пожалуйста, примите это как правило: 6 месяцев или более.

+236
Yacine Sibous 1 дек. 2012 г., 02:07:28

У меня BTC в бумажный кошелек. Какой обмен или кошелек я могу внести в то, что будет разбить его на BTC и ВСН? И тогда позвольте мне снять? В обмен я использовал и вывел на BTC из предварительно разделенных сейчас торгуется ВСН, но не разделяя ни БТД, что не было на бирже во время раскола.

+221
shwetha 26 янв. 2010 г., 01:16:48

Вы пробовали восстановление кэша шрифтов? Это помогает во многих случаях.

РМ ~/.пакет fontconfig
судо ФК-Cache-Ф -в
+214
MikeUnchined 12 февр. 2024 г., 21:46:46

Ластик смерти появлялись исключительно в экспериментальных Тетрадь Смерти глава, которая не является каноном.

Если пилот главе было рассмотрено канона несколько вещей, которые противоречили бы сами, как правила Тетради Смерти содержать, что существует бесконечное количество страниц в Тетради Смерти, в то время как в экспериментальной версии говорится, что он имеет 60 страниц с 38 строк на странице.

+124
justis 17 мар. 2016 г., 09:16:13

Я слышал, что поезда в США часто очень поздно, по разным причинам; см., например, каково состояние железнодорожной поездки в США? и его ответы. Но опять же, единственная страна, где я не слышал, чтобы жители жалуются, что поезда за границу являются более надежными, чем в своей стране-Швейцария1, поэтому я предпочитаю факты. По данным Википедии страница на Амтрак, надежность значительно улучшилось (выделено мной):

Операторы грузовых железнодорожных требуются в соответствии с Федеральным законом диспетчеризации предпочтение Амтрак поезда. Некоторые железные дороги были обвинены в нарушении или обхода настоящих Правил, якобы, в результате пассажирских поездов в тупиках в ожидании в течение часа или дольше в ожидании грузовых перевозок для очистки трассы. Практики направления железных дорог были исследованы в 2008 году,[67], что приведет к более строгие законы О железнодорожном приоритет, который был драматический результат. В целом амтрэка на время производительность выросла с 74,7% в 2008 финансовом году до 84,7% в 2009 году, с поездов дальнего следования и другим внешним НЭК видя наибольшую выгоду. Реки Миссури Бегун вскочил из очень бедной 11% до 95%, став одним из лучших исполнителей Амтрэка. Техасский орел пошел с 22,4% до 96,7%, а Калифорнийский зефир, с плачевным 5% на рекорд в 2008 году выросла на 78,3%.[68] тем не менее, улучшение показателей также совпала с общим экономическим спадом, в результате низких объемов грузовых железнодорожных перевозок как минимум с 1988, то есть меньше грузовых перевозок препятствовать пассажиропотоку.[69]

Амтрак на их сайте есть ежемесячные отчеты. В ноябре 2012 года, что Калифорнийский зефир имеет конец-в-конец по времени исполнения записи 93.3% (стр. 96). Для поездов дальнего следования, о времени, определяется как в течение 30 минут. Ярмарка достаточно, но это относится к сквозной по времени исполнения. Если я не останусь до конечного пункта, тогда это не очень актуально для меня. Я сталкивался как минимум два раза в Швеции, что был ночной поезд опоздал на два часа вечером, но по времени на следующее утро. Поэтому на время статистики для станций вдоль трассы вполне уместны.

Где, если угодно, я могу найти Амтрак на время статистики для произвольного станций, расположенных вдоль маршрута, в отличие от сквозного времени статистика?

Если таковых не имеется, есть ли другой информации, указывающей, является ли это общим для Амтрак поезда опаздывать по маршруту, но по времени в конце, или если задержки по маршруту, а, как правило, придерживаются?


1я слышал, как говорят британцы поезда в Голландии лучше, голландцы отмечают немецкие поезда лучше, немцы утверждают швейцарские поезда лучше, норвежцы считают шведские поезда лучше, шведы утверждают финские поезда лучше, Финны говорят, что российские поезда лучше, и приехав во многих из этих стран, все, что я могу подтвердить, что швейцарские поезда надежны.

+105
aman singh 17 окт. 2019 г., 17:33:48

Чтобы ответить на оба вопроса "Что писать" и "зачем они просят об этом," я процитирую ответ от @badroit на соответствующий вопрос (который касается написания научной заявлению):

Вы пытаетесь продемонстрировать, почему вы и ваш фон хорошо подходит для летней школы, и что вы получите большую пользу от этой школы.

Общая идея-это же для написания "почему я хочу побывать" заявление: вы хотите, чтобы показать организаторам летней школы, что они не будут тратить свое время и другие ресурсы на вас.

Итак, две вещи, которые вы хотите, чтобы убедитесь, что ваш ответ несет, являются:

  1. Что вы искренне увлечены этой темой. Объясняя (как вы предлагаете), что связь между биологией и математикой что-то вы очень любопытны об/интересует вполне разумные вещи пишешь. Также можно отметить обзоры курсовых работ или проектов, которые Вы предприняли, чтобы продемонстрировать ваш интерес в этой области.
  2. Что вы получите пользу от Летней школы. Обсудить актуальные цели, которые вы думаете, что эта школа поможет вам достичь, например, своем намерении принимать выпускников курсов по теме как старший, проводить самостоятельные исследования/исследования в этой области, чтобы пойти в аспирантуру в биоматематики и т. д.

Наконец, если есть профессор в смежных областях, с которыми вы имеете какое-то отношение (например, вы взяли его/ее класса), вы можете задать их для рассмотрения вашей летней школы, прежде чем отправлять его. Это имеет двойную пользу: (1) получать квалифицированную помощь с вашим приложением, и (2) развивать отношения с преподавателями в вашей области интереса.

+59
patison666 19 окт. 2015 г., 08:00:25

Я обновил некоторые фотографии, которые сидели на моем телефоне в течение длительного времени, показывая цветок и плод. quinceЕсть несколько заброшенные и заросшие айвы на моем рабочем месте, которое все еще удается потушить несколько фруктов. Принимая черенки допустимо (и что действительно нуждается в помощи, обрезка-мудрый.) Если я хочу укоренить черенки от него (или иначе пропагандируют это), что лучшим временем для принятия их и способ от этого момента?

Хммм. Я думаю, это скорее всего "цветение айвы" chaneomeles; хотя это несколько непонятно. Наверняка подходит "только предположительно полезных для варенья", но я не есть фрукты полезно изучить - это не много, а остальные были удалены кем-то или чем-то еще. Пахнет хорошо, на вкус ужасно терпкий, но это, кажется, наиболее подходят для "айва." Я надеялся, что пробовать небольшую партию варенья из него, но теперь я склоняюсь к попытке нового Буша в мой собственный место для этого. Flower and leaves

Фрукты, безусловно, яблоко размером - выглядит-то вроде Гренни Смит с небольшим красным румянцем (но более текстура/меньше блеска кожи) большую часть времени его там, хотя в некоторые годы она фактически приступила к желтой в конце сезона Quince Fruit and leaf

+16
bev 2 мая 2020 г., 00:20:19

Показать вопросы с тегом