Вопросы с тегом 'all-fours'

Ну, это не полный ответ, но никто не ответил. Так что я думаю, я принимаю это. :-) пожалуйста, см. Мой редактировать. В случае кажется странным, что я должен был бы знать это; я делаю расчеты, основан ...
25

Пользовательское восстановление, пользовательские ROM для Micromax холст сок 3 плюс q394

Вы можете сделать: ф=0 для ARG В -Е-в сделать ф=$((ф+1)) тр '>\N' в '\п>' <входной_файл | команда grep "$арг" '>.\{200\}'| тр '>\N' в '\п>' >"./выходной_файл$Ф" сделано Который будет писать все последовательности 200 символов или больше outfile1 и всех тех, короче outfile2. Он переводит все > к \пewlines и наоборот - так что ваш первый пример выше становится: TCONS_00000066 gene=XLOC_000030>CCGCCGGCTGCTGCGCGCACCGACTTGTCACCACCCCAGCACGTCCTCCACGTATACAAG>CGCTACGGTCCACCGCGGCAGCGTCGACGTCCTTGTCCGCAAACATGGTGGTGGCAGCTT>CCTCATCGAGCAGCAGCAACTCATCCTCGAGGGGAAGG ...
10 янв. 2016 г., 11:43:38
24

стоимость печати от первой линии на каждой линии

Вот мое понимание как разработчик: Андроид 1.5-2.1: справа налево поддержка встроенный, но большинство дисков не содержат букв. Это означает, что иврит в большинство приложений будут отображаться как поля (но в правильном порядке). Это позволит отдельных приложений, чтобы включить свои собственные шрифты и показать тем самым правильно на иврите. Для Android 2.2: системные шрифты по умолчанию теперь включает иврите. Справа-налево по-прежнему работает. (Хотя правила для оправдания изменилась, досадно.) ...
31 мая 2021 г., 01:23:59
25

настройка xkb_keymap в nixos

У вас есть несколько вариантов для установки программного обеспечения. Для установки Firefox (которые должны были уже установлены в большинстве дистрибутивов Убунту) вы можете открыть терминал и введите: судо apt-получить установку для Firefox Кроме того, вы можете использовать менеджер пакетов Synaptic чтобы как загрузить и установить Firefox для вас. Любой из способов позволит извлечь из поддерживаемых репозиториях. ...
21 янв. 2014 г., 15:06:49
20

Непрерывный многоадресного трафика с маршрутизатора

Я добавив много фильмов в последнее время в iTunes. Проблема в том, что размер растет очень быстро. Я ценю, имеющие метаданные в одном месте, но я хочу перенести файлы на внешний диск. Предпочтительно, я мог бы иметь непросмотренные фильмы на жесткий диск и перенести их на внешний диск после того, как они смотрели. Ссылка в iTunes должны храниться, и метаданные сохранены, как. У меня есть папки, организованные в iTunes, и я знаю, что трюк, чтобы "держать команду и клавишами Option и перетащите файл(ы) ...
25 мар. 2012 г., 00:41:25
15

Как перевести BTC из ядро, которое никогда не заканчивается syncho на другой кошелек?

Попробуйте это: apt-получить удалить Гугл-Хром-стабильный (или какой версии вы работаете) команда CD ~/.конфиг РМ -РФ Гугл-Хром/ после выхода и входа и запуска хрома. Он должен появиться в лаунчере теперь. Это сработало для меня :) ...
5 мая 2017 г., 08:21:40
20

Депрессия аспирант в США, желающих бросить курить

Есть несколько вещей, которые я могу думать. Во-первых, вы уверены, что ваша печь при правильной температуре? Хотя ваша духовка может сигнал, что она подогрета, не проверив его с духовкой или инфракрасный термометр вы не можете быть уверены, что это на самом деле на температуру необходимое - и даже если он при этом температуры, при которой датчик, она не может быть одинаковой температуры везде в духовку. Попробуйте переместить стойку вы используете один или два уровня ближе или дальше от элементов и посмотреть, ес ...
14 мая 2016 г., 13:11:36
20

Как сделать, чтобы sendmail сохранить плюс деталь для .вперед?

В некоторых отношениях это легче продолжить прямо на доктора. Письма вы получаете в обоснование ходатайства будет посвежее и академически ориентированным. Вам не придется иметь дело с "ржавыми" по понятиям или за раз по теории. Она также может быть трудно, чтобы вернуться к жизни в качестве студента, если вы привыкли жить на зарплату, а также получить некоторые обязательства, которые могут быть трудно иметь дело со студентом. Вы можете, конечно, использовать любой путь, чтобы исследовать, является ли это п ...
14 мар. 2023 г., 05:37:07
15

Используя АБР резервного копирования для восстановления файлов на Андроид

Я хочу удалить приложение сорванец, но когда я запускаю apt-получить удалить сорванец Я получаю информацию, что и в GNOME приложения будут удалены. Как это можно предотвратить? Или, может быть, это может быть достигнуто: как я могу удалить сорванец и держать все другие пакеты, которые приходят с гномом? ...
13 дек. 2010 г., 06:57:35
17

есть ли блендер/кухонный комбайн комбо все-таки сделал?

Пройти -О опция к ПС , чтобы контролировать, какие поля он выводит. Если вы добавите = знак после заполнения всех полей, то в заголовке строки опускается. Использовать е вместо топора придерживаться стандартных функций (это будет работать на любой не-античной системы Unix). Фильтр с грэп не надежные. Например, если вы запустите эту команду из скрипта под названием Посмотри на котяру, то ваш скрипт будет сочетается хорошо. Вот более надежный способ, который ищет в JVM процесс с орг."Апач".Каталина.за ...
1 июн. 2018 г., 03:10:27
19

Стеклянное защитное плита

Вы можете использовать кореша , который позволяет выполнять "действия" при изменении местоположения. Расположение сообщается с помощью сети Wi-Fi, что означает, что вы можете делать вещи, когда Wi-Fi изменится. Кореша-это приложение, которое автоматически обновляет настройки ноутбука на основе, где вы находитесь. Просто установите приложение, настроить места, которые вы часто посещаете, (дом, работа, кафе и т. д.) и никогда больше возни с настройками! ...
11 янв. 2012 г., 19:23:43